366 – Ebola, los políticos y tú, por, Miryam Dietrich

¡Buen dia angelito humano! Calor. Asaltos. Fondos Buitres. Narcotráfico. Mujeres Hot. Cuestiones personales e intimas ventiladas en Facebook y los medios de comunicación. Mentiras en los dirigentes. Más mentiras. Amigas queridas que se mudan de país. Confusión. Más calor. Principios tirados y pisoteados. Leyes espúreas. Aceptación de Normal lo Anormal. Mentes hiperactivas. Monos desatados. Mentiras con el Ebola. Humanos dormidos. Humanos aferrados a la zona de comodidad. Presión. Bajo la apariencia de “seguridad” humanos vigilados con cámaras, drones, google. Y más cámaras. La ilusión de sentirse libres cuando en realidad cada día se está más preso. Ausencia de definiciones. Miedo. Miedo, Miedo. Indiferencia frente a las guerra y las muertes de otros angelitos humanos.
Confusión aguda en el exceso de información. Drogas por doquier.

Y sin embargo… amigas de ley. Amigos extraordinarios. Amor entre humanos. Solidaridad. Humanos buscando respuestas por todos lados. Muchos ya saliendo de l famosa “new Age” que es una ilusión dentro de la ilusión de la Matrix.

Oración. Silencio. Amor. Y más amor. Y ejercicio del perdón.

¡¡¡Guauuuuu y reguuuuuuuuuuaaaaauuuuuu! Humanos saliendo del Truman Show, rompiendo el telón. Algunos solo espían detrás de un agujero. Aun no se animan. Pero ya la semilla está plantada.

¡Atrévete angelito humano! El perdón y el amor es lo único verdadero. Dios es amor. El universo es amor.

¡¡¡¡Puffffff!!! Atrévete. Ejercita la verdadera libertad que consiste en SER TU MISMO. Y no lo que otros te dicen que seas o que tú crees que debes ser ( o se distinto de lo que eres).

Los angelitos humanos despiertos, comenzamos a ser más. Y más. Y más.

Pobrecitas estas almitas que ejercen poder terrenal de forma inadecuada y se olvidan que esta vida es solo un soplo en la eternidad de sus almas.
Ya somos muchos y vamos por muchos más. OBSERVA. DISCIERNE. PERDONA-TE. AMA-TE.

ESTATE ATENTO A LAS SEÑALES DE LOS ANGELES. ELLOS ESTAN TRABAJANDO ACTIVAMENTE PERO TU ANDAS DISTRAIDO. PRESTA ATENCION. ORA. Y DETEN EL MONO LOCO.

Elevemos una oración en silencio para aquellos angelitos humanos que estando dormidos, sus almas claman a gritos el despertar.

Te amo. Amo la vida. Amo mis amigos, Amo a los animales. Amo a la Madre tierra. Amo  a los ángeles. Simplemente…. amo.

Miryam Dietrich

257 – Qónclave de Ángeles y Humanos, por Miryam Dietrich

Buen día tengas angelito humano: me encuentro en Villa La Angostura (Patagonia Argentina) donde ELLOS me trajeron para que, en profundos silencios, pudiera meditar y re-organizar mi tarea contigo.

Villa La Angostura -Patagonia Argentina - Junio 2012

 

¡¡¡Puff!!! Estaba tan entusiasmada con escribir “Quentos que no son Quentos” que desde las nubes me tenían que dar un tirón de orejas para que saliera a caminar.

Claro que, cuando lo hacía y bajaba la montaña rumbo al Lago Nahuel Huapi, bueno…. ¡Guauuuu y reguauuu!!!! me extasiaba, caminaba por su orilla, contemplaba las montañas con sus picos cubiertos de nieve y mi alma se elevababa más allá de las nubes.

Lago Nahuel Huapi - Villa La Angostura (Patagonia Argentina), por Miryam Dietrich

¿Estás adivinando que me pasó?

¡¡¡SIIIIIII!!! Escribí otro cuento, perdón quento. Dame tiempo para que te lo envíe.

Tengo tanta pero tanta magia en mi interior, salen tantas palabras que se me traban los dedos sobre el teclado. ¡Es que es muchísimo  lo que deseo compartir contigo!

Ayyyy! Perdona, ya me estaba desviando del tema.

La cuestión es que estaba organizando la agenda 2012, donde tengo proyectados viajes al extranjero, libros para publicar,  Quentos, Talleres, atención de personas, Canalizaciones a distancia  y todo eso, cuando   ELLOS  “aparecieron” y me dijeron:

“BASTA DE TALLERES . ESTOS ENCUENTROS YA NO SON TALLERES . TÚ TE LO PASAS DICIENDO QUE NO DESEAS SER MAESTRA. QUE SÓLO ASPIRAS A QUE LOS ANGELITOS HUMANOS RECUERDEN QUE SON CHISPITA DE DIOS Y QUE LA TERCERA DIMENSIÓN (CAOS, PIQUETES, REVUELTAS, PAROS, VIOLENCIA, DOLARIZACIÓN, PESIFICACIÓN etc) ES UNA ILUSIÓN QUE PUEDE SER DISUELTA A TRAVÉS DEL AMOR Y EL PERDÓN. BUENO, MUJER, LA PALABRA A PARTIR DE HOY PARA TUS ENCUENTROS ES “QÓNCLAVE” TE AMAMOS. NOSOTROS TUS ÁNGELES DEL CIELO”

¡Que fuerte es este mensaje! ¿verdad?. Claro, que ELLOS tiran así las cosas y luego en esta tercera dimensión hay que organizarlas. ¡¡¡Pufff!!! Bueno, fuí a internet y me encontré con la siguiente definición de Qónclave (porque quería que te llegara la idea completa):

“Cónclave: Reunión o congreso de personas que se reúnen para tratar algún asunto”.

Megaretiro con Angeles Villa Pehuenia abril 2012, por Miryam Dietrich

Y ¡me encantó!.

¿Por qué me gustó tanto la palabra “Qónclave”? Ayyyy! Síiiii! ¡Claro que sé que se escribe con “C” pero ELLOS me han dado como un “¿sello interno?” y me dicen que escriba usando  la “Q”.

¿Viste que parece que la palabra tuviera más fuerza?

Es que… son momentos para tener mucha fuerza interior, sino lo externo te entristece. ¡Claro que lo entiendo!Y me encantó esa “Q”. Está re-genial, copada me dicen los más jóvenes.

Y creo que ELLOS que son pícaros y muy simpáticos, lo sugieren para que tú que andas tan distraído por el mundo de la tercera dimensión y todos los temas de los vaivenes políticos, te detengas y leas con tu corazón que es este QONCLAVE.

Bueno, ¡¡¡¡puffff! Otra vez me corrí. Buehhhh!!! Sigamos

Es un Qonclave porque no enseño nada y simplemente doy testimonio de mi vida: de cuando estuve dos veces muerta y me “devolvieron”, de mis maestros, de mis miedos, de lo adicta que fui a la infelicidad, de cómo vivo plena practicamente todo el tiempo, de cómo a través del AMOR que las personas me brindaron  ( y me brindan) y el PERDÓN, sané mi vida y curé mis enfermedades, de que comprensión diferente tengo sobre la Muerte, de mis dos bellos querubines nietitos que partieron al Padre, Juan y Bianca que están en el Cielo etc etc etc

Bueno, ahora sí, esto tiene un nuevo marco y me gusta. ¡Claro que me gusta!

Patagonia Argentina, junio 2012 por Miryam Dietrich

Y teniendo presente que en QÓNCLAVE DE ÁNGELES Y HUMANOS, trabajaremos con la SINFONÍA ANGELICAL, desde un lugar muy diferente. ¡Guauuuu y reguauuuuu! ¡Estoy feliz! Cuando desees conocer más datos, escríbeme a miryamdietrich@gmail.com

La Hermana Analía, cuando comenté este cambio, me dijo: “Conclave me suena a tiempo de antes, tal vez le de solidez a los encunetros, podría ser con el complemento familiar, es decir conclave familiar( flia humana), ya que de ahora en más lo digas o no, podrías tener una motivación oculta, que fuera a Laura Vicuña, protectora de las niñas y jóvenes en riesgo, ( mujeres), y ella es protectora de las familias, la familia humana que a gritos grita! unanse! contengan, cuiden, protejan, hablan, dialoguen, humanicen…”

Que el AMOR y el PERDÓN sean las bases de tu vida Villa La Angostura (Patagonia Argentina) un frío, congelado, amanecer de un 10 de junio de 2012

Miryam Dietrich

Publico esto desde Valeria del Mar, Provincia de Buenos Aires, República Argentina un 25 de junio de 2012, mientras veo amanecer desde mi ventana

Pstttt: te cuento bajito en tu oído que estrenaremos esta nueva forma de conexión con ELLOS el miércoles 11 de julio a las 20 horas, en Valeria del Mar en el Apart El Rey del Bosque, en Azopardo y Greenville. Pstttt!!! Shhssss! No le cuentes a nadie. Ya voy a escribir sobre esto.

Despacito te digo: hasta luego hermoso ser de luz!!!!

211 – Retiro de Ángeles en Tenjo – Bogotá Colombia Junio 2011

Los angelitos que acompañan a Rueca de Almas a Bogotá, viajarán a Tenjo – Bogotá- Colombia en el mes de junio de 2011.

Sigamos sumando almas en esta bellísima tarea de hilar.

Estaremos con un bello retiro en la Casa de Anahata Ishaya que se llama el Portal de Juaica desde las 20 horas del viernes 3 de junio de 2011 al lunes 6 de junio al mediodia. Para más datos pueden llamar a Anahata al celular  310 5587851

Portal de Juaica ( de Anahata Ishaya) donde se realizará el Retiro de Angeles en Colombia del 3 al 6 de junio de 2011, por Miryam Dietrich

Hilemos y juntemos a tantas almitas hambrientas de la más bella Luz de ELLOS.

El amor siempre triunfa. Siempre.

Vista de la Casa de Retiros de Anahata Ishaya donde se realizará el Retiro con Angeles de Miryam Dietrich desde el 3 de junio al 6 de junio de 2011

Ya volveré con más datos.

Un especial  abracito lleno de plumitas de ángeles para todos los colombianos

Miryam

192 – Pidele a Dios que se haga el milagro, por Miryam Dietrich

Amado ángel humano: en este domingo tan temprano, sentí el “toque” de Dios en mi alma y mi corazón saltó emocionado. . De purísima “casualidad” escuché a la Oneness Band y esa letra me conmovió hasta lo más profundo de mi ser.

Hoy el escrito es largo. Hoy rompo mi propia regla de escribir poco.

Pero tú… que pides el milagro, te mereces leer lo que me ha sido dictado.

Y mientras lees, observa a tu alrededor y siente que ELLOS están ahí aguardando que tú les digas cuál es el milagro que deseas en este día en el que especialmente, para Dios, eres muy amado.

Hoy le dedico esto a mis amigas Jela  de Música de Cariló, Selfa de Madariaga, María Marta y Cristian del Apart El Rey del Bosque de Valeria del Mar, y a Marcia, Marco y  Rosamarié que tan amorosamente me cobijaron en el casco viejo de la estancia La Invernada en la Provincia de Santa Fe.

Y cuando hayas terminado de leer ( si es que tu “mono loco” te lo permite y no te estás apurado para ir corriendo a hacer… nada) te invito a que escuches la ONENEES BAND en Pídele a Dios. Ojalá te hagas el tiempo para escuchar toda la letra.

Desde mi refugio en Valeria del Mar, te envio este mensaje alado.

Buen domingo lleno de amor para tí

Miryam Dietrich

LOS MILAGROS Y LOS GUARDIANES ALADOS por Miryam Dietrich

Escrito en el casco viejo de la Estancia La Invernada – Provincia de Santa Fé a las 6,56 am de un 27 de octubre de 2010-11-14

¿DUDAS HUMANO

DE LOS LLAMADOS MILAGROS?

¿QUÉ SUCEDE CON LA FÉ

ESA QUE TODO LO SOSTIENE?

AVANZAN Y RETROCEDEN

BUSCAN Y REBUSCAN

GRITAN QUE NO SIENTEN

EL AMOR DE DIOS TODO COMPLACIENTE.

HABÍA UNA VEZ…

UNA HISTORIA DE MIL DRAMAS

Y TÚ, AMADO HUMANO,

ERAS TÚ QUIÉN TEJÍA LA TRAMA.

DIJIMOS: EL AMOR TODO LO PUEDE

EL AMOR TODO LO SANA

MÁS TU OLVIDAS EL AMOR

PARA VIVIR EL CULEBRÓN

QUE TODO LO EMBARRA.

¡HUMANO! ¿POR QUÉ TE MALTRATAS?

LEVANTA TUS OJOS AL CIELO

Y … HABLA.

NOSOTROS, QUE EN LO ALTO ESTAMOS,

PARA AYUDAR FUIMOS CREADOS

Y PARA CUMPLIR TAL MISIÓN

TÚ DEBES RECORDAR

QUE SOMOS TUS GUARDIANES ALADOS.

HUMANO, TU VOLTEAS LA CABEZA

Y VES ENEMIGOS POR TODOS LADOS

MÁS, SI EN EL PASTO TE ACUESTAS

Y TE CONECTAS CON EL VELO SAGRADO

PRONTO NOS SENTIRÁS

AHÍ, MUY CERQUITA

CASI A TU LADO.

OBSERVATE HUMANO

Y MIRA A TUS HERMANOS.

TODOS SUFREN LA AUSENCIA DEL AMOR DE DIOS

QUE CREEN … LES HA SIDO NEGADO.

LA TRIBU HUMANA ESTÁ DESPERTANDO

Y AUNQUE LOCO PAREZCA

A MÁS GUERRA, MÁS AMOR

SERA REVELADO.

SACUDE HUMANO  DE TUS ESPALDAS

EL DOLOR DE TODO LO EXPERIMENTADO

TOMA A TUS HERMANOS DE LAS MANOS

Y HÚNDETE EN EL BAÑO DORADO

DEL AMOR DE DIOS

Y DE TODO LO POR ÉL CREADO.

DUERME, EL HUMANO, DUERME

HASTA QUE EL DOLOR LO TOCA

EN EL CENTRO DE SU FRENTE.

Y EN EL BARRO DEL DOLOR

CHAPOTEA EL HUMANO

A VECES SIN CRITERIO

MUCHAS OTRAS SIN RAZÓN,

PARA REENCONTRAR EL AMOR DE DIOS

TANTAS VECES OLVIDADO.

Y BUSCA EL HUMANO, BUSCA

LA SOGA QUE LO SAQUE

DE ESE BARRO TAN EMBARRADO.

Y PARA HACERLO MIRA

HACIA ABAJO VIENDO

DE TANTO EN TANTO EN EL LODO ESPEJADO

UN PÁLIDO REFLEJO

DE CIELO Y NUBES.

Y CREYENDO ENTONCES

QUE A DIOS HA ENCONTRADO

 SE TIRA DE CABEZA

PARA TERMINAR…

MÁS EMBARRADO.

HUMANO: LEVANTA TUS OJOS

Y MIRA EL CIELO ESTRELLADO

DEJA QUE TU CORAZÓN PALPITE ALOCADO

Y LUEGO … MIRA A TU HERMANO

EN CADA UNO DE ELLOS

HAY UNA CHISPA DE DIOS

QUE TÚ HUMANO

… PARECES HABER OLVIDADO.

Y CUANDO A DIOS ENCUENTRES

MIRANDO AL DE AL LADO

ESE SERÁ … TU VERDADERO MILAGRO

Los Guardianes Alados de 7ma dimensión

 Y aquí te cuelgo la Oneness Band. Escúchalo entero

Pidele a Dios

Si has llegado hasta este punto, eres un ángel humano que, además de serlo, está recordando que es una chispa de Dios en este mundo que pareciera tan alocado.

Gracias

Miryam

El circo de la Mariposa, de Eduardo Verástegui

Hola! te cuento que estaba trabajando en esta web y entró un correo de mi querida amiga Cecilia Sosa Peñalba de Salta, quién realiza un excelente trabajo de comunicación e información para muchísima gente. Desde hace años.

Y me llamó la atención el nombre de EL CIRCO DE LA MARIPOSA. E ingresé a los links.

Cecilia escribió: El corto “The Butterfly Circus”, coprotagonizado por el actor mexicano Eduardo Verástegui, ha ganado el primer premio del concurso de cortos “The Doorpost Film Project”. Este premio, de 100.000 dólares, reconoce la aportación del corto a la promoción de valores como la esperanza y la dignidad humana. En esta ocasión, los valores eran la esperanza, el perdón, la humildad, la alegría, la libertad y la redención.”

Estoy con mi amiga Julia en Capilla del Monte y cuando terminamos de ver los dos videos, Julia lloraba literalmente a “moco tendido” y yo tenía toda mi piel erizada de pura emoción.

Ahí decidí levantar los links en esta web   porque es mi más ferviente deseo que le llegue a todo el mundo como prueba que el ser humano SIEMPRE SIEMPRE SIEMPRE PUEDE FRANQUEAR SUS PROPIOS LIMITES Y CREAR LO MEJOR PARA SU SER CUALQUIERA SEA SUS CIRCUNSTANCIAS.

Entonces te dejo una reflexión: ¿cual es el drama que te impide vivir feliz? Ninguno. Sólo que cuando sufres, estás prisionero de tu propia mente.

Con amor y GRACIAS CECILIA CHISPITA DE LUZ

Miryam

http://www.youtube.com/watch?v=9582NStUdqU&feature=player_embedde

http://www.youtube.com/watch?v=BUBPX28_mAE&feature=player_embedded (esta segunda parte comienza en inglés pero luego tiene los subtítulos en español)

2009-06-08 Por qué esta web?, por Miryam Dietrich

Por qué esta web?

No es una web religiosa ni pretender serlo. No está encolumnada en ninguna corriente filosófica o metafísica.

Y si buscan encasillarla o meterla en alguna “cajita” de definición, creo que les va a resultar dificilísimo, porque, como tantas cosas de la vida, esta web también es única.

Personalmente, tengo tantos conocimientos intelectuales de “cómo deberían ser las cosas que deben ser” que … ¡ME AGOTÉ!.

Ya es hora de conectar mente y corazón. Ya es hora de sentir.

¿Creen ustedes que no pueden sentir a través de una web?

Lean. Y fíjense si sienten o no emociones.

Esta web … es simplemente una web.

En ella vuelco mis praxis, mis experiencias, mis sentires y los de tantas personas que me conocen y me rodean.

Una vez, una hermana de vidas pasadas y amiga del alma de esta vida, que se llama Elena y es de La Plata, me dijo: ” por favor, hablá en nombre de los que no tienen voz”.

En ese momento, yo estaba rodeada e inmersa en profundo, profundísimo dolor emocional, físico y síquico por esas cosas que suceden en la vida.

No presté atención en aquel momento, pero la frase quedó ahí, colgada de una nube y cada tanto, sonaba en mi cerebro como un péndulo. Y luego se iba.

Y hoy, creo que hablar en nombre de los que no tienen voz, es una de mis misiones de vida, como también hacer “oir” a quienes padecen cierto tipo de sordera.

Nuestros amados Guías siempre están acá, con nosotros. Y no se los escucha. El miedo y las creencias incorporadas por múltiples factores a nuestras vidas, producen cierto tipo de sordera.

Y así andamos. A puro tumbos nomás.

Las únicas reglas que rigen lo que hago en este segmento de mi vida, son el amor incondicional, el perdón, el regocijo en Dios, alegría, Fé, confianza, el placer de la conexión con los Ángeles, Guías y Maestros, el servir a otros, el ayudar a otros y ayudarme a mí misma, el disfrutar la vida por el sólo hecho de vivir.

No sé si lo logro. Y cuando lo logro no sé si es lo correcto. Más … SÉ QUE ES LO PERFECTO PARA MÍ.

Ver vidas pasadas y canalizar a los ángeles de las personas, es algo que, para describirlo, carezco de palabras.

Pero, sé y afirmo, que luego de una de esas sesiones, el amor y el perdón se instala en el corazón de quién recibe y a mí, me recicla toda mi energía con una suavidad, que es realmente angelical.

Mi aprendizaje nunca se acaba. Todas las noches me acuesto con la sabiduría de una anciana, por lo aprendido durante el día. Y todas las mañanas me despierto como una bebé por lo que me resta aprender.

Para quienes deseen compartir aprendizaje y/o experiencia en esta aventura de ser humanos, sean bienvenidos y conecténse por correo electrónico.

Les amo profundamente, en María Nuestra Madre

Miryam Dietrich